Stem-loop hsa-mir-106a
Mirna Stemloop Summary
| id | hsa-mir-106a |
| Accession | MI0000113 |
| Comments | This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
| Database Links | hsa-mir-106a |
| Description | Homo sapiens miR-106a stem-loop |
| Gene Family | MIPF0000001;mir-17 |
| Genome Context | chrX: 134170198-134170278 [-] |
| miRna Matures Links | |
| Sequence | CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG |