id | hsa-mir-96 |
Accession | MI0000098 |
Comments | This sequence is localised to chromosome 7 and was named mir-96-7 in reference [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
Database Links | hsa-mir-96 |
Description | Homo sapiens miR-96 stem-loop |
Gene Family | MIPF0000072;mir-96 |
Genome Context | chr7: 129774692-129774769 [-] |
miRna Matures Links | |
Sequence | UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA |