id | hsa-mir-106a |
Accession | MI0000113 |
Comments | This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
Database Links | hsa-mir-106a |
Description | Homo sapiens miR-106a stem-loop |
Gene Family | MIPF0000001;mir-17 |
Genome Context | chrX: 134170198-134170278 [-] |
miRna Matures Links | |
Sequence | CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG |